Lớp phủ thủy tinh-gốm được cấu trúc nano cho các ứng dụng chỉnh hình - Phần 3


2.2 Độ bền liên kết và độ cứng vi mô

   Độ bền liên kết bền kéo giữa lớp phủ   chất nền     đo lường   trong   phù hợp   với   ASTM   C-633-79.   Các   thử nghiệm   thủ tục   có thể   được   tìm   trong   công việc trước đây của chúng tôi [ 32 ]. Năm mẫu được kiểm tra độc lập   cho   mỗi   kiểu   của   lớp phủ     các   các kết quả   đã được báo cáo   như   trung bình ± sd

Độ cứng siêu nhỏ của lớp phủ đã được thử nghiệm trên bề mặt lớp phủ được đánh bóng bằng cách sử dụng máy đo độ cứng siêu nhỏ Shimadzu (Công ty Shimadzu, Nhật Bản) với tải trọng 300 gf và   một   tải   thời gian   của   15 giây   Trước   thử nghiệm,   lớp phủ   đã được đề cập   đến   fi ne   đánh bóng.   Độ cứng   giá trị   đã được ghi lại   trên   15   khác nhau   vị trí.  

Các   các kết quả   được trình bày   như   nghĩa là ± sd

 


Bảng 1. Các mồi được sử dụng cho RT-PCR - các dấu hiệu liên quan đến HOB.


gen

trình tự   ( 5 '   - 3 ' )

nhiệt độ nóng chảy (℃)

GAPDH

F ACCCAGAAGACTGTGGATGG

60


R CAGTGAGCTTCCCGTTCAG


Runx-2

F ATGCTTCATTCGCCTCAC

60


R ACTGCTTGCAGCCTTAAAT


OPN

F TTCCAAGTAAGTCCAACGAAAG

60


R GTGACCAGTTCATCAGATTCAT


collagen loại I

F AGGGTCCCAACGAGATCGAGATCCG

60


R TACAGGAAGCAGACAGGGCCAACGTCG


BSP

F ATGGCCTGTGCTTTCTCAATG

60


R GGATAAAAGTAGGCATGCTTG


 


2.3. Phát hành ion và thử nghiệm khoáng chất acellular

     Để đo các hành vi giải phóng ion của HT và SP, chúng được ngâm trong 7 ngày trong dung dịch natri clorua 15 ml (pH 7,4) đệm với tris (hydroxymethyl) aminomethane và axit clohydric (dung dịch đệm HCl-tris). Sau khi ngâm, giá trị pH của dung dịch đệm được đo và nồng độ ion đã được thử nghiệm bằng cuộc đảo chính cảm ứng dẫn đến phổ phát xạ nguyên tử plasma (ICP-OES, Optima 3000 DV, USA).

Khả năng của lớp phủ để tạo ra sự kết tủa của các hợp chất Ca và phốt pho (P) được đánh giá bằng cách ngâm lớp phủ trong môi trường nuôi cấy không có tế bào. Tóm lại, lớp phủ được khử trùng bằng cách ngâm trong dung dịch ethanol 70 phần trăm qua đêm, và sau đó rửa sạch với nước muối đệm phosphate (PBS) trước khi ngâm trong môi trường nuôi cấy. Ba mililit môi trường nuôi cấy được thêm vào từng giếng của đĩa nuôi cấy 12 giếng có chứa các mẫu phủ. Các mẫu phủ được ủ ở 37 trong môi trường ẩm, 5% CO 2 trong 5 h, và sau đó rửa sạch bằng nước siêu tinh khiết, sấy khô và cacbon bị phún xạ để quan sát SEM. Thành phần hóa học của các trầm tích hình thành trên bề mặt lớp phủ sau khi khoáng hóa được phân tích bằng cách sử dụng quang phổ phân tán năng lượng (EDS), được gắn với công cụ SEM.


2.4. Phân lập và nuôi cấy tế bào xương người nguyên phát

Giấy phép sử dụng mô người bị loại bỏ đã được Ủy ban Đạo đức Con người của Đại học Sydney cấp và đã nhận được sự đồng ý. Tế bào xương nguyên phát của con người (HOB) được phân lập từ xương trabecular bình thường của con người như đã mô tả trước đây [34]. Tóm lại, xương được chia thành 1 mm3 miếng, rửa sạch nhiều lần trong PBS, và tiêu hóa với 0,02% (w / v) trypsin (Sigma –Aldrich, USA) trong PBS, pH 7,4, trong 90 phút ở 37 ℃. Các tế bào sau đó được nuôi cấy trong môi trường hoàn chỉnh có chứa một môi trường thiết yếu tối thiểu (a-MEM, Gibco Laboratories, USA), bổ sung 10% (v / v) huyết thanh bê thai tạm ngưng hoạt động (FCS, Gibco Laboratories), 2 mM L-glutamine (phòng thí nghiệm Gibco), 25 mM đệm Hepes (Gibco Laboratories), 2 mM natri pyruvate, 30 mg ml -1 penicillin, 100 mg ml -1 streptomycin (Gibco Laboratories) và 0,1 mM L-ascorbic acid phosphate magnesium salt ( Hóa chất tinh khiết Wako, Osaka, Nhật Bản). Các tế bào được nuôi cấy ở 37 ℃ trong một bầu không khí 5 phần trăm CO 2 và phương tiện truyền thông được làm mới mỗi ba ngày. Khi hợp lưu, các tế bào được truyền đi và các tế bào ở đoạn 3 được sử dụng trong các thí nghiệm.



2.5. Sự gắn bó di động và quan sát hình thái

Sau khi các tế bào đạt đến 80-90% hợp lưu, chúng đã được sử dụng TrypLE Express (Invitrogen), sau đó được ly tâm và treo trong môi trường hoàn chỉnh để tạo ra một huyền phù tế bào với mật độ 3,4 × 10 4 tế bào trên mililít. Sau đó, một huyền phù tế bào 1 ml được thêm vào mỗi giếng của một tấm nuôi cấy tế bào 24 giếng có chứa các mẫu phủ. Sau khi nuôi cấy trong 2, 5 và 24 giờ, các tế bào được cố định trong dung dịch paraformaldehyde 4% , sau cố định sử dụng 1% osmium tetroxide trong PBS trong 1 h, sau đó khử nước trong một dung dịch ethanol đã được phân loại (30, 50, 70, 90, 95 và 100%), và cuối cùng sấy khô trong hexamethyldisilizan trong 3 phút. Các mẫu sơn khô đã bị phún xạ vàng trước khi quan sát SEM.



2.6. Xét nghiệm tăng sinh tế bào

T ông CellTiter 96 Dung dịch nước (Promega, USA), một phương pháp đo màu, được sử dụng để xác định số lượng tế bào sống sót. Xét nghiệm là một dung dịch kết hợp của hợp chất tetrazolium 3- (4,5-dimetylthiazol-2-yl) -5- (3-carboxymetoxyphenyl) -2- (4-sulphophenyl-2H-tetrazolium) (MTS) và thuốc thử ghép nối electron (phenazine methosulphate) với tỷ lệ thể tích là 20: 1. Hợp chất trước đây có thể được bioreduced bởi các tế bào sống thành một formazan, hòa tan trong môi trường nuôi cấy tế bào. Vì vậy, độ hấp thụ của formazan ở 490 nm tỷ lệ thuận với số lượng tế bào sống. Bốn mẫu của mỗi loại sơn được kiểm tra cho mỗi điểm thời gian và các đĩa Ti-6Al-4V không tráng được sử dụng làm bộ điều khiển. Tóm lại, 1 ml huyền phù tế bào có mật độ tế bào 8,5 × 10 4 cell ml -1 được thêm vào từng giếng của một đĩa nuôi cấy 24 giếng có chứa các mẫu phủ. Sau 3 và 7 ngày, môi trường nuôi cấy đã được thay thế bằng 700 ul dung dịch làm việc MTS, đó là dung dịch pha loãng 5 lần của xét nghiệm CellTiter 96 dung dịch nước trong PBS. Sau 4 giờ ủ thêm, 100 ml dung môi làm việc đã được chuyển đến một đĩa cấy tế bào 96 giếng để đo độ hấp thụ bằng đầu đọc microplate (PathTech) ở 490 nm.


2.7. Phản ứng chuỗi polymerase thời gian thực định lượng

HOB được gieo hạt trên các mẫu phủ ở mật độ tế bào 2 × 10 4 cell cm -2 và nuôi cấy trong 1 ngày và 7 ngày. Sau mỗi thời điểm, tổng số RNA được phân lập d từ các HOB được nuôi cấy trên các mẫu phủ và mẫu kiểm soát của đĩa Ti-6Al-4V không tráng bằng cách sử dụng Trizol (Sigma) theo hướng dẫn của nhà sản xuất. Sợi cDNA đầu tiên được tổng hợp từ 0,7 ug RNA tổng số bằng cách sử dụng Omniscript RT Kit (Qiagen, USA) theo hướng dẫn của nhà sản xuất. Sau đó, cDNA được phân tích bằng PCR thời gian thực (Rotor-Gene 6000, Corbett Life Science) cho các gen liên quan đến xương sống: Runx-2, collagen type I, osteopontin (OPN) và sialoprotein xương (BSP) và biểu hiện gen tương đối của chúng mức độ thu được bằng cách bình thường hóa với glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

Chất mồi được sử dụng cho các gen được chọn được liệt kê trong bảng 1.


2.8. Phân tích thống kê

Dữ liệu thu được từ bốn thí nghiệm độc lập và được biểu diễn dưới dạng trung bình ± sd Để phân tích thống kê , chương trình SPSS 17.0 đã được sử dụng. Thử nghiệm của Levene được thực hiện để xác định tính đồng nhất của phương sai cho tất cả các dữ liệu, và sau đó các bài kiểm tra sau của Tukey HSD được sử dụng cho dữ liệu với phương sai đồng nhất, nếu không, bài học T2 của Tamhane được sử dụng.

Giá trị p nhỏ hơn 0,05 được xem là đáng kể.



******còn tiếp******